Sekvenssi (biologia)

Siirry navigaatioon Siirry hakuun
DNA:n sekvensoinnin tulos, jossa selvitetty sekvenssi on merkitty kirjaimina kuvan alalaidassa. Kirjaimella kuvataan kyseisen nukleotidin emästä: guaniinia (G), adeniinia (A), tymiiniä (T) tai sytosiinia (C).

Sekvenssi tarkoittaa makromolekyylin monomeerien järjestystä molekyylin primaarirakenteessa, esimerkiksi nukleotidien järjestystä nukleiinihapossa tai aminohappotähteiden järjestystä polypeptidissä.[1] Järjestyksellä voi olla merkittäviä vaikutuksia molekyylin toimintaan; esimerkiksi DNA:n sisältämä geneettinen informaatio on säilötty nukleotidien järjestykseen. Koska DNA:n nukleotidit poikkeavat toisistaan ainoastaan emäsosaltaan, DNA:n sekvenssillä tarkoitetaan sen emäsjärjestystä.[2]

Nukleiinihappo- ja polypeptidisekvenssit liittyvät kiinteästi toisiinsa geneettisen koodin kautta: DNA-sekvenssi määrittää sen koodaaman RNA-molekyylin ja sitä kautta polypeptidin sekvenssit. Polypeptidin sekvenssi puolestaan määrittää siitä ja mahdollisesti muista polypeptideistä muodostuvan proteiinin rakenteen ja fysikokemialliset ominaisuudet, jotka edelleen määrittävät kyseisen proteiinin tehtävän solussa.[3]

Sekvenssianalyysillä voidaan selvittää molekyylien ominaisuuksia. Eri organismeilta peräisin olevia sekvenssejä voidaan vertailla keskenään, jotta saadaan tietoa esimerkiksi lajien välisistä yhtäläisyyksistä ja eroista. Vertailussa käytetään hyväksi bioinformatiikan menetelmiä. Vertaamalla vasta löydetyn proteiinin sekvenssiä tunnettuihin proteiinisekvensseihin voidaan tehdä johtopäätöksiä uuden proteiinin rakenteesta ja toiminnasta pelkästään sen sekvenssin perusteella.[3]

Molekyylin sekvenssin selvittämiseen käytettyä menetelmää kutsutaan sekvensoinniksi.[4]

Merkintätavat[muokkaa | muokkaa wikitekstiä]

Nukleiinihapposekvenssit[muokkaa | muokkaa wikitekstiä]

  1. Nukleiinihapposekvenssi esitetään 5’–3’-suunnassa, jos suuntaa ei ole erikseen määritetty sekvenssin yhteydessä. Vasemmalla puolella on sekvenssin 5’-pää, jonka nukleotidin pentoosin viidenteen hiiliatomiin on kiinnittynyt vapaa fosfaattiryhmä. Oikealla puolella on puolestaan sekvenssin 3’-pää, jonka nukleotidin pentoosin kolmannen hiiliatomin hydroksyyliryhmä on vapaa.[2]
  2. Nukleotidit nimetään niiden emäsosien mukaan. Yksittäistä emästä tai mahdollista emäsryhmää merkitään sekvensseissä yleensä IUPAC:in määrittämällä kirjaimella.[5]

Esimerkkejä nukleiinihapposekvensseistä:

  • DNA-sekvenssi 5’–3’-suunnassa: 5’–GATAAATCTGGTCTTATTTCC–3’
  • Ylläoleva DNA-sekvenssi 3’–5’-suunnassa: 3’–CCTTTATTCTGGTCTAAATAG–5’
  • Ensimmäisen sekvenssin kanssa identtinen RNA-sekvenssi 5’–3’-suunnassa: 5’–GAUAAAUCUGGUCUUAUUUGG–3’

Aminohapposekvenssit[muokkaa | muokkaa wikitekstiä]

  1. Aminohapposekvenssin aminohappotähteet merkitään yleensä siten, että vasemmalla puolella on aminohappoketjun aminoterminaali ja oikealla puolella karboksiterminaali.[2]
  2. Aminohappoja kuvataan joko yksi- tai kolmikirjaimellisilla lyhenteillä.[2]

Esimerkkejä aminohapposekvensseistä:


Lähteet[muokkaa | muokkaa wikitekstiä]

  1. Biologia: sekvenssi Tieteen termipankki. Viitattu 23.2.2020. (suomeksi)
  2. a b c d Morris, James & Hartl, Daniel & Knoll, Andrew & Lue, Robert: Biology: How Life Works, s. 2-12, 2-13, 3-6, 4-5. New York: Macmillan, 2013. ISBN 978-1-4641-5601-4. (englanniksi)
  3. a b Husi, Holger: ”Chapter 4: Biological Sequence Analysis”, Computational Biology. Brisbane (AU): Codon Publications, 2019. ISBN 978-0-9944381-9-5. Teoksen verkkoversio (viitattu 23.2.2020). (englanniksi)
  4. Biotekniikka: sekvensointi Tieteen termipankki. Viitattu 23.2.2020. (suomeksi)
  5. a b Johnson, Andrew D: An extended IUPAC nomenclature code for polymorphic nucleic acids. Bioinformatics, 15.5.2010, 26. vsk, nro 10, s. 1386–1389. PubMed:20202974. doi:10.1093/bioinformatics/btq098. Artikkelin verkkoversio Viitattu 23.2.2020. (englanniksi)
  6. Amino acid abbreviations International Nucleotide Sequence Database Collaboration. Viitattu 29.2.2020. (englanniksi)